FLAG-PPP2R5E siRNA-resistant
(Plasmid
#120861)
-
Purposeexpresses dox-inducible PPP2R5E resistant to siRNA pool 2 used in manuscript
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerThermoFIsher
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 6700
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPP2R5E
-
Alt nameB56 epsilon
-
Alt nameB' epsilon
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1437
-
Mutationsilent mutation at aa 282-284 in PPP2RE to generate siRNA-resistant RNA
-
Entrez GenePPP2R5E (a.k.a. B56E, B56epsilon)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GAAAGTATTGATCCCTTTACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byopenbiosystems
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-PPP2R5E siRNA-resistant was a gift from Emily Foley (Addgene plasmid # 120861 ; http://n2t.net/addgene:120861 ; RRID:Addgene_120861) -
For your References section:
The PP2A(B56) phosphatase promotes the association of Cdc20 with APC/C in mitosis. Lee SJ, Rodriguez-Bravo V, Kim H, Datta S, Foley EA. J Cell Sci. 2017 May 15;130(10):1760-1771. doi: 10.1242/jcs.201608. Epub 2017 Apr 12. 10.1242/jcs.201608 PubMed 28404789