Skip to main content

P35m
(Plasmid #120946)

  • Purpose
    MoClo golden gate assembly AB part for pLbda-CasRQi (strong lambda promoter with downstream dCas binding site for Qi-lab gRNA (UC16m); gRNA sequence taken from DOI: 10.1016/j.cell.2013.02.022).
  • Depositing Lab
  • Depositing Organization
    California Institute of Technology
    Located in United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120946 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    DVA
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    KL740
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pLbda-CasRQi
  • Species
    Synthetic
  • Insert Size (bp)
    99

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCGTATCACGAGGCA
  • 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Very strong promoter! To avoid mutations, grow this plasmid in KL740 E. coli, or another strain containing lambda cI. If in KL740, grow at 30degreesC. Please see Supplemental Documents for annotated Genbank file.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P35m was a gift from Richard Murray (Addgene plasmid # 120946 ; http://n2t.net/addgene:120946 ; RRID:Addgene_120946)