pAH233
(Plasmid #121144)

• Purpose: Expression of gRNA with BbsI placeholder for target cloning
• Depositing Lab: Katsunori Tanaka
• Publication: Hayashi et al G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976.

Backbone

• Vector backbone: pREP1
• Backbone size w/o insert (bp): 6556
• Total vector size (bp): 8996
• Vector type: Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA cassette
• gRNA/shRNA sequence: CACCGGGTCTTCGAGAAGACCTGTtttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaaagtgagtggcaccgagtcggtggtgc
• Species: S. pombe (fission yeast)
• Promoter: S.pombe rrk1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Pst I (destroyed during cloning)
• 3′ cloning site: SacI (destroyed during cloning)
• 5′ sequencing primer: CACACATGAACAAGGAAGTACAGG
• 3′ sequencing primer: AGATAAGTCACTATGTCCGAGTG

Resource Information

• Supplemental Documents:
  • CRISPRcas9 fission yeast Protocol

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.