pAH237
(Plasmid #121146)

• Purpose: Expression of both nmt41p-cas9 and rrk1p-gRNA (LEU2 marker) for CRISPR genome editing in fission yeast
• Depositing Lab: Katsunori Tanaka
• Publication: Hayashi et al G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976.

Backbone

• Vector backbone: pAH233
• Backbone size w/o insert (bp): 8996
• Total vector size (bp): 15440
• Modifications to backbone: no BbsI site in LEU2 marker gene
• Vector type: Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: gRNA cassette
• Species: S. pombe (fission yeast), Synthetic
• Promoter: S.pombe rrk1

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (destroyed during cloning)
• 3′ cloning site: SacI (destroyed during cloning)
• 5′ sequencing primer: CACACATGAACAAGGAAGTACAGG
• 3′ sequencing primer: CAGATAAGTCACTATGTCCGAGTG

Gene/Insert 2

• Gene/Insert name: humanized Streptococcus pyogenes Cas9
• Species: S. pombe (fission yeast), Synthetic
• Insert Size (bp): 6439
• Promoter: nmt41
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (destroyed during cloning)
• 3′ cloning site: NcoI (destroyed during cloning)
• 5′ sequencing primer: TCTCACTTTCTGACTTATAGTCGCT
• 3′ sequencing primer: GATCACCATCATGGAAAGAAGCAG

Resource Information

• Supplemental Documents:
  • CRISPRcas9 fission yeast Protocol
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308.

Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.