Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAH237
(Plasmid #121146)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 121146 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAH233
  • Backbone size w/o insert (bp) 8996
  • Total vector size (bp) 15440
  • Modifications to backbone
    no BbsI site in LEU2 marker gene
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    gRNA cassette
  • Species
    S. pombe (fission yeast), Synthetic
  • Promoter S.pombe rrk1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (destroyed during cloning)
  • 3′ cloning site SacI (destroyed during cloning)
  • 5′ sequencing primer CACACATGAACAAGGAAGTACAGG
  • 3′ sequencing primer CAGATAAGTCACTATGTCCGAGTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    humanized Streptococcus pyogenes Cas9
  • Species
    S. pombe (fission yeast), Synthetic
  • Insert Size (bp)
    6439
  • Promoter nmt41
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site NcoI (destroyed during cloning)
  • 5′ sequencing primer TCTCACTTTCTGACTTATAGTCGCT
  • 3′ sequencing primer GATCACCATCATGGAAAGAAGCAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308.

Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH237 was a gift from Katsunori Tanaka (Addgene plasmid # 121146 ; http://n2t.net/addgene:121146 ; RRID:Addgene_121146)
  • For your References section:

    Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408