Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAH235
(Plasmid #121145)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 121145 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLF273
  • Backbone size w/o insert (bp) 8460
  • Total vector size (bp) 12736
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    S.pombe ura4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized Streptococcus pyogenes Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4276
  • Promoter nmt41
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (destroyed during cloning)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TCTCACTTTCTGACTTATAGTCGCT
  • 3′ sequencing primer AGCAGTACTGGCAAGGGAGAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH235 was a gift from Katsunori Tanaka (Addgene plasmid # 121145 ; http://n2t.net/addgene:121145 ; RRID:Addgene_121145)
  • For your References section:

    Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408