pAH235
(Plasmid
#121145)
-
PurposeCas9 expression controlled by the nmt41 promoter
-
Depositing Lab
-
Depositing OrganizationKwansei Gakuin University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSLF273
- Backbone size w/o insert (bp) 8460
- Total vector size (bp) 12736
-
Vector typeYeast Expression, CRISPR
-
Selectable markersS.pombe ura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized Streptococcus pyogenes Cas9
-
SpeciesSynthetic
-
Insert Size (bp)4276
- Promoter nmt41
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer TCTCACTTTCTGACTTATAGTCGCT
- 3′ sequencing primer AGCAGTACTGGCAAGGGAGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH235 was a gift from Katsunori Tanaka (Addgene plasmid # 121145 ; http://n2t.net/addgene:121145 ; RRID:Addgene_121145) -
For your References section:
Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408