Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107550)


Item Catalog # Description Quantity Price (USD)
Plasmid 107550 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    PX330 (Addgene #42230)
  • Total vector size (bp) 8090
  • Modifications to backbone
    Removed sgRNA expression cassette.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Humanized S. pyogenes Cas9
  • Alt name
  • Insert Size (bp)
  • Mutation
  • Promoter CBh
  • Tag / Fusion Protein
    • 3XFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pX-evoCas9 was obtained through modifications of the PX330 backbone (Addgene #42230)
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX-evoCas9 was a gift from Anna Cereseto (Addgene plasmid # 107550 ; ; RRID:Addgene_107550)
  • For your References section:

    A highly specific SpCas9 variant is identified by in vivo screening in yeast. Casini A, Olivieri M, Petris G, Montagna C, Reginato G, Maule G, Lorenzin F, Prandi D, Romanel A, Demichelis F, Inga A, Cereseto A. Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066. 10.1038/nbt.4066 PubMed 29431739