Skip to main content

pGAD-Atg17(L313D I314K)
(Plasmid #121390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121390 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGAD-c1
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATG17
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Leucine 313 to Aspartic acid; Isoleucine 314 to Lysine
  • Promoter ADH1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (unknown if destroyed)
  • 3′ cloning site Sal1 (unknown if destroyed)
  • 5′ sequencing primer atcacggctagtaaaattgatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGAD-Atg17(L313D I314K) was a gift from Daniel Klionsky (Addgene plasmid # 121390 ; http://n2t.net/addgene:121390 ; RRID:Addgene_121390)
  • For your References section:

    The Atg17-Atg31-Atg29 Complex Coordinates with Atg11 to Recruit the Vam7 SNARE and Mediate Autophagosome-Vacuole Fusion. Liu X, Mao K, Yu AYH, Omairi-Nasser A, Austin J 2nd, Glick BS, Yip CK, Klionsky DJ. Curr Biol. 2016 Jan 25;26(2):150-160. doi: 10.1016/j.cub.2015.11.054. Epub 2016 Jan 7. 10.1016/j.cub.2015.11.054 PubMed 26774783