pGBDU-Atg17(L105D)
(Plasmid
#121395)
-
PurposeFor Yeast-two-hybrid analysis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGBDU-c1
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATG17
-
SpeciesS. cerevisiae (budding yeast)
-
MutationLeucine 105 to Aspartic acid
- Promoter ADH1 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla1 (unknown if destroyed)
- 3′ cloning site Pst1 (unknown if destroyed)
- 5′ sequencing primer gtgaataaagatgccgtcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGBDU-Atg17(L105D) was a gift from Daniel Klionsky (Addgene plasmid # 121395 ; http://n2t.net/addgene:121395 ; RRID:Addgene_121395) -
For your References section:
The Atg17-Atg31-Atg29 Complex Coordinates with Atg11 to Recruit the Vam7 SNARE and Mediate Autophagosome-Vacuole Fusion. Liu X, Mao K, Yu AYH, Omairi-Nasser A, Austin J 2nd, Glick BS, Yip CK, Klionsky DJ. Curr Biol. 2016 Jan 25;26(2):150-160. doi: 10.1016/j.cub.2015.11.054. Epub 2016 Jan 7. 10.1016/j.cub.2015.11.054 PubMed 26774783