Skip to main content
Addgene

PacrAB-rfp + Pconst-yfp
(Plasmid #121445)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121445 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PacrAB-rfp + Pconst-yfp in SC101 origin vector
  • Vector type
    Bacterial Expression, Synthetic Biology ; pBb vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Pconst-yfp
  • Promoter Pconst

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTATCAAAAAGAGTATTGACA
  • 3′ sequencing primer GTGTCCCTCTCGATGGCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PacrAB-rfp
  • Promoter PacrAB

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCAGTAGATTGCACCGCG
  • 3′ sequencing primer TCGTGCTATGGTACATACATTCACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PacrAB-rfp + Pconst-yfp was a gift from Mary Dunlop (Addgene plasmid # 121445 ; http://n2t.net/addgene:121445 ; RRID:Addgene_121445)
  • For your References section:

    Heterogeneity in efflux pump expression predisposes antibiotic-resistant cells to mutation. El Meouche I, Dunlop MJ. Science. 2018 Nov 9;362(6415):686-690. doi: 10.1126/science.aar7981. 10.1126/science.aar7981 PubMed 30409883