PacrAB-rfp + Pconst-yfp
(Plasmid
#121445)
-
Purposeplasmid reporting the expression from acrAB and constitutive promoters
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePacrAB-rfp + Pconst-yfp in SC101 origin vector
-
Vector typeBacterial Expression, Synthetic Biology ; pBb vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePconst-yfp
- Promoter Pconst
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTATCAAAAAGAGTATTGACA
- 3′ sequencing primer GTGTCCCTCTCGATGGCTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePacrAB-rfp
- Promoter PacrAB
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCAGTAGATTGCACCGCG
- 3′ sequencing primer TCGTGCTATGGTACATACATTCACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PacrAB-rfp + Pconst-yfp was a gift from Mary Dunlop (Addgene plasmid # 121445 ; http://n2t.net/addgene:121445 ; RRID:Addgene_121445) -
For your References section:
Heterogeneity in efflux pump expression predisposes antibiotic-resistant cells to mutation. El Meouche I, Dunlop MJ. Science. 2018 Nov 9;362(6415):686-690. doi: 10.1126/science.aar7981. 10.1126/science.aar7981 PubMed 30409883