-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV5
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxo1 ADA
-
Alt nameFkhr ADA
-
Alt nameFoxo1
-
Alt nameforkhead box O1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1700
-
MutationThreonine 24 to Alanine (A) and Serine 253 to Aspartate (D) and Serine 316 to Alanine (A)
-
GenBank IDNM_019739
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Myc (N terminal on backbone)
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid has K219R, G282R, and L619P polymorphisms. Addgene quality control sequencing also identified an E15G mutation that is not thought to affect protein function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-Foxo1ADA(pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12149 ; http://n2t.net/addgene:12149 ; RRID:Addgene_12149) -
For your References section:
FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein R, Gu W, Accili D. Cell Metab. 2005 Sep . 2(3):153-63. 10.1016/j.cmet.2005.08.004 PubMed 16154098