Skip to main content

pAAV-DIO-trkB.DN-mCherry
(Plasmid #121502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121502 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5591
  • Total vector size (bp) 7667
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    trkB.T1
  • Alt name
    truncated version of tyrosine receptor kinase B
  • Alt name
    NTrk2 variant 2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2076
  • Entrez Gene
    Ntrk2 (a.k.a. RATTRKB1, TRKB1, Tkrb, trk-B, trkB)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggccagcttggcacttgatg
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    trkB.T1 is cloned from prattrkBT1 from Lino Tessarollo's group at National Cancer Insitute, NIH

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DIO-trkB.DN-mCherry was a gift from Marie Carlén (Addgene plasmid # 121502 ; http://n2t.net/addgene:121502 ; RRID:Addgene_121502)
  • For your References section:

    Adult trkB signaling in parvalbumin interneurons is essential to prefrontal network dynamics. Guyon N, Zacharias LR, van Lunteren JA, Immenschuh J, Fuzik J, Martin A, Xuan Y, Zilberter M, Kim H, Meletis K, Lopes-Aguiar C, Carlen M. J Neurosci. 2021 Feb 15. pii: JNEUROSCI.1848-20.2021. doi: 10.1523/JNEUROSCI.1848-20.2021. 10.1523/JNEUROSCI.1848-20.2021 PubMed 33593856