pAAV-DIO-trkB.DN-mCherry
(Plasmid
#121502)
-
PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5591
- Total vector size (bp) 7667
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlease use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametrkB.T1
-
Alt nametruncated version of tyrosine receptor kinase B
-
Alt nameNTrk2 variant 2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2076
-
Entrez GeneNtrk2 (a.k.a. RATTRKB1, TRKB1, Tkrb, trk-B, trkB)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ggccagcttggcacttgatg
- 3′ sequencing primer GCAATAGCATGATACAAAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bytrkB.T1 is cloned from prattrkBT1 from Lino Tessarollo's group at National Cancer Insitute, NIH
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DIO-trkB.DN-mCherry was a gift from Marie Carlén (Addgene plasmid # 121502 ; http://n2t.net/addgene:121502 ; RRID:Addgene_121502) -
For your References section:
Adult trkB signaling in parvalbumin interneurons is essential to prefrontal network dynamics. Guyon N, Zacharias LR, van Lunteren JA, Immenschuh J, Fuzik J, Martin A, Xuan Y, Zilberter M, Kim H, Meletis K, Lopes-Aguiar C, Carlen M. J Neurosci. 2021 Feb 15. pii: JNEUROSCI.1848-20.2021. doi: 10.1523/JNEUROSCI.1848-20.2021. 10.1523/JNEUROSCI.1848-20.2021 PubMed 33593856