Skip to main content

LL - hOCT4i -2
(Plasmid #12197)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12197 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 7650
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OCT4 - RNAi
  • Alt name
    OCT4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    55
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer mU6-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LL - hOCT4i -2 was a gift from George Daley (Addgene plasmid # 12197 ; http://n2t.net/addgene:12197 ; RRID:Addgene_12197)
  • For your References section:

    High-efficiency RNA interference in human embryonic stem cells. Zaehres H, Lensch MW, Daheron L, Stewart SA, Itskovitz-Eldor J, Daley GQ. Stem Cells. 2005 Mar . 23(3):299-305. 10.1634/stemcells.2004-0252 PubMed 15749924