Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #122006)


Item Catalog # Description Quantity Price (USD)
Plasmid 122006 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 5917
  • Vector type
    Bacterial Expression
  • Tag / Fusion Protein
    • His6-3xAvi (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at .

Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:

LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'

LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCoofy52 was a gift from Sabine Suppmann (Addgene plasmid # 122006 ; ; RRID:Addgene_122006)
  • For your References section:

    A new method to customize protein expression vectors for fast, efficient and background free parallel cloning. Scholz J, Besir H, Strasser C, Suppmann S. BMC Biotechnol. 2013 Feb 14;13(1):12. 10.1186/1472-6750-13-12 PubMed 23410102