pCoofy62
(Plasmid
#122014)
-
Purpose(Empty Backbone) Mammalian vector for parallel SLIC cloning containing the VEGF signal sequence for secretion, N-terminal His6-Smt3Star (SumoStar*) and different C-tag options
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTT22
-
Backbone manufacturerNRC (Yves Durocher)
- Backbone size (bp) 5293
-
Vector typeMammalian Expression
-
Tags
/ Fusion Proteins
- His6-Smt3Star (N terminal on insert)
- Multi3: depending on the LP2 primer, either no C-tag, C-10His, C-TwinStrep, or C-EPEA is inserted (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. C-terminal 10x His tag is flanked by stop codons. Depending on the LP2 primer used in SLIC, this C-terminal tag can be fused to the target gene. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki .
Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select a LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3', 10His- SLIC Primer 5'GAGCATCATCATCATCACCAC 3', TwinStrep- SLIC Primer 5' AGCGCTTGGAGCCACCCGCAG 3', EPEA- SLIC Primer 5' GAACCGGAAGCGTGAGCGGCCG 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCoofy62 was a gift from Sabine Suppmann (Addgene plasmid # 122014 ; http://n2t.net/addgene:122014 ; RRID:Addgene_122014) -
For your References section:
A new method to customize protein expression vectors for fast, efficient and background free parallel cloning. Scholz J, Besir H, Strasser C, Suppmann S. BMC Biotechnol. 2013 Feb 14;13(1):12. 10.1186/1472-6750-13-12 PubMed 23410102