Skip to main content

pCoofy64
(Plasmid #122016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122016 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac
  • Backbone manufacturer
    Thermo
  • Backbone size (bp) 5694
  • Vector type
    Insect Expression
  • Tags / Fusion Proteins
    • His6-Smt3Star (N terminal on insert)
    • Multi3: depending on the LP2 primer, either no C-tag, C-10His, C-TwinStrep, or C-EPEA is inserted (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. C-terminal 10x His tag is flanked by stop codons. Depending on the LP2 primer used in SLIC, this C-terminal tag can be fused to the target gene. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki .

Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:

LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'

LP2 - select a LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3', 10His- SLIC Primer 5'GAGCATCATCATCATCACCAC 3', TwinStrep- SLIC Primer 5' AGCGCTTGGAGCCACCCGCAG 3', EPEA- SLIC Primer 5' GAACCGGAAGCGTGAGCGGCCG 3'

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCoofy64 was a gift from Sabine Suppmann (Addgene plasmid # 122016 ; http://n2t.net/addgene:122016 ; RRID:Addgene_122016)
  • For your References section:

    A new method to customize protein expression vectors for fast, efficient and background free parallel cloning. Scholz J, Besir H, Strasser C, Suppmann S. BMC Biotechnol. 2013 Feb 14;13(1):12. 10.1186/1472-6750-13-12 PubMed 23410102