Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRVdG-4FLPo
(Plasmid #122050)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122050 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.

Backbone

  • Vector backbone
    cSPBN (pSAD)
  • Backbone manufacturer
    Karl-Klaus Conzelmann & Matthias Schnell
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLPo
  • Species
    Synthetic
  • Insert Size (bp)
    1299
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
  • 3′ sequencing primer TAGACCTCTCCAGGATCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVdG-4FLPo was a gift from Ian Wickersham (Addgene plasmid # 122050 ; http://n2t.net/addgene:122050 ; RRID:Addgene_122050)
  • For your References section:

    "Self-inactivating" rabies viruses are susceptible to loss of their intended attenuating modification. Jin L, Matsuyama M, Sullivan HA, Zhu M, Lavin TK, Hou Y, Lea NE, Pruner MT, Dam Ferdinez ML, Wickersham IR. Proc Natl Acad Sci U S A. 2023 Feb 14;120(7):e2023481120. doi: 10.1073/pnas.2023481120. Epub 2023 Feb 6. 10.1073/pnas.2023481120 PubMed 37053554