Skip to main content

pRRLSIN.cPPT.PGK.NeuroD2.WPRE
(Plasmid #122054)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122054 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK.WPRE
  • Backbone size w/o insert (bp) 6667
  • Total vector size (bp) 7819
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NeuroD2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1152
  • GenBank ID
    NM_010895.3
  • Entrez Gene
    Neurod2 (a.k.a. Ndrf, bHLHa1)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGTCGGCTCCCTCGTTGACC
  • 3′ sequencing primer CAGCGTATCCACATAGCGTAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRLSIN.cPPT.PGK.NeuroD2.WPRE was a gift from Stephen Tapscott (Addgene plasmid # 122054 ; http://n2t.net/addgene:122054 ; RRID:Addgene_122054)
  • For your References section:

    Conversion of MyoD to a neurogenic factor: binding site specificity determines lineage. Fong AP, Yao Z, Zhong JW, Johnson NM, Farr GH 3rd, Maves L, Tapscott SJ. Cell Rep. 2015 Mar 31;10(12):1937-46. doi: 10.1016/j.celrep.2015.02.055. Epub 2015 Mar 19. 10.1016/j.celrep.2015.02.055 PubMed 25801030