p3xEGFP-N1
(Plasmid
#122163)
-
PurposeExpression of 3xEGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xEGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTGGTTTAGTGAACCGTCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The MCS of multimeric EGFP vectors differs from the MCS of the monomeric EGFP vector (pEGFP-N1):
G CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT GAA ATC GAA TTC CCG CGG GCC CGG GAT CCA CCG GTC GCC ACC ATG GTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3xEGFP-N1 was a gift from Georg Mayr (Addgene plasmid # 122163 ; http://n2t.net/addgene:122163 ; RRID:Addgene_122163) -
For your References section:
A set of enhanced green fluorescent protein concatemers for quantitative determination of nuclear localization signal strength. Bohm J, Thavaraja R, Giehler S, Nalaskowski MM. Anal Biochem. 2017 Sep 15;533:48-55. doi: 10.1016/j.ab.2017.06.015. Epub 2017 Jun 30. 10.1016/j.ab.2017.06.015 PubMed 28669708