Skip to main content

mycBioID-pBabePuro-myc-BirA*KRASG12V
(Plasmid #122211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122211 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mycBioID-pBABE-puro
  • Backbone size w/o insert (bp) 6213
  • Total vector size (bp) 6777
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRASG12V
  • Alt name
    KRAS4B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    564
  • Mutation
    changed G12 to V
  • GenBank ID
    NM_004985
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Tag / Fusion Protein
    • myc-BirA* (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mycBioID-pBabePuro-myc-BirA*KRASG12V was a gift from Christopher Counter (Addgene plasmid # 122211)
  • For your References section:

    Interrogating the protein interactomes of RAS isoforms identifies PIP5K1A as a KRAS-specific vulnerability. Adhikari H, Counter CM. Nat Commun. 2018 Sep 7;9(1):3646. doi: 10.1038/s41467-018-05692-6. 10.1038/s41467-018-05692-6 [pii] PubMed 30194290