pLenti-TK-Firefly-cjMGA
(Plasmid
#122280)
-
PurposeLentiviral vector for stable expression of Firefly luciferase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti-TK-Firefly-Control
- Backbone size w/o insert (bp) 9199
- Total vector size (bp) 9573
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirefly luciferase
-
SpeciesSynthetic; Pyrophorus plagiophthalamus
-
Insert Size (bp)1653
-
GenBank IDACJ37466.1
Gene/Insert 2
-
Gene/Insert namecjMGA 3'UTR
-
SpeciesCallithrix jacchus
-
Insert Size (bp)378
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCTGACAGAAACAACCAGCGC
- 3′ sequencing primer gGGGACCCaaaagaaaaggggggaGGGGATACCCCCTAGAGCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-TK-Firefly-cjMGA was a gift from Demián Cazalla (Addgene plasmid # 122280 ; http://n2t.net/addgene:122280 ; RRID:Addgene_122280) -
For your References section:
Viral miRNA adaptor differentially recruits miRNAs to target mRNAs through alternative base-pairing. Gorbea C, Mosbruger T, Nix DA, Cazalla D. Elife. 2019 Sep 20;8. pii: 50530. doi: 10.7554/eLife.50530. 10.7554/eLife.50530 PubMed 31538617