Skip to main content

pLenti-TK-Firefly-cjSTK4
(Plasmid #122282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122282 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-TK-Firefly-Control
  • Backbone size w/o insert (bp) 9199
  • Total vector size (bp) 9504
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Firefly luciferase
  • Species
    Synthetic; Pyrophorus plagiophthalamus
  • Insert Size (bp)
    1653
  • GenBank ID
    ACJ37466.1

Gene/Insert 2

  • Gene/Insert name
    cjSTK4 3'UTR
  • Species
    Callithrix jacchus
  • Insert Size (bp)
    309

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCTGACAGAAACAACCAGCGC
  • 3′ sequencing primer gGGGACCCaaaagaaaaggggggaGGGGATACCCCCTAGAGCCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-TK-Firefly-cjSTK4 was a gift from Demián Cazalla (Addgene plasmid # 122282 ; http://n2t.net/addgene:122282 ; RRID:Addgene_122282)
  • For your References section:

    Viral miRNA adaptor differentially recruits miRNAs to target mRNAs through alternative base-pairing. Gorbea C, Mosbruger T, Nix DA, Cazalla D. Elife. 2019 Sep 20;8. pii: 50530. doi: 10.7554/eLife.50530. 10.7554/eLife.50530 PubMed 31538617