Skip to main content

px335-sgRNA-EF(Cas9n)-Jade1-R
(Plasmid #122326)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122326 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px335
  • Backbone size w/o insert (bp) 8427
  • Total vector size (bp) 8447
  • Modifications to backbone
    We applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA for mouse Jade1
  • gRNA/shRNA sequence
    GATATCTGTCCTCCTGCTGA
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1_5_primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px335-sgRNA-EF(Cas9n)-Jade1-R was a gift from Hiroshi Ochiai (Addgene plasmid # 122326 ; http://n2t.net/addgene:122326 ; RRID:Addgene_122326)
  • For your References section:

    Genome-wide kinetic properties of transcriptional bursting in mouse embryonic stem cells. Ochiai H, Hayashi T, Umeda M, Yoshimura M, Harada A, Shimizu Y, Nakano K, Saitoh N, Liu Z, Yamamoto T, Okamura T, Ohkawa Y, Kimura H, Nikaido I. Sci Adv. 2020 Jun 17;6(25):eaaz6699. doi: 10.1126/sciadv.aaz6699. eCollection 2020 Jun. 10.1126/sciadv.aaz6699 PubMed 32596448