px335-sgRNA-EF(Cas9n)-Ncapd3-R
(Plasmid
#122330)
-
PurposeExpresses sgRNA targeting mouse Ncapd3 and Cas9 nickase in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx335
- Backbone size w/o insert (bp) 8427
- Total vector size (bp) 8447
-
Modifications to backboneWe applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for mouse Ncapd3
-
gRNA/shRNA sequenceGGGCCTTACGAAGGGACCTC
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO1_5_primer (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px335-sgRNA-EF(Cas9n)-Ncapd3-R was a gift from Hiroshi Ochiai (Addgene plasmid # 122330 ; http://n2t.net/addgene:122330 ; RRID:Addgene_122330) -
For your References section:
Genome-wide kinetic properties of transcriptional bursting in mouse embryonic stem cells. Ochiai H, Hayashi T, Umeda M, Yoshimura M, Harada A, Shimizu Y, Nakano K, Saitoh N, Liu Z, Yamamoto T, Okamura T, Ohkawa Y, Kimura H, Nikaido I. Sci Adv. 2020 Jun 17;6(25):eaaz6699. doi: 10.1126/sciadv.aaz6699. eCollection 2020 Jun. 10.1126/sciadv.aaz6699 PubMed 32596448