pLenti/TO/EYFP-P2A-IDH1(HA)
(Plasmid
#122482)
-
PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti/TO/DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7725
- Total vector size (bp) 9375
-
Modifications to backboneThe V5 tag was replaced by a 3xFLAG sequence
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameisocitrate dehydrogenase 1
-
Alt nameEYFP-IDH1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2163
-
Entrez GeneIDH1 (a.k.a. HEL-216, HEL-S-26, IDCD, IDH, IDP, IDPC, PICD)
- Promoter CMV/TO
-
Tags
/ Fusion Proteins
- P2A
- HA (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAA
- 3′ sequencing primer CAGAGGTTGATTGTCGAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti/TO/EYFP-P2A-IDH1(HA) was a gift from Eric Huang (Addgene plasmid # 122482 ; http://n2t.net/addgene:122482 ; RRID:Addgene_122482) -
For your References section:
Functional requirement of a wild-type allele for mutant IDH1 to suppress anchorage-independent growth through redox homeostasis. Tiburcio PDB, Xiao B, Berg S, Asper S, Lyne S, Zhang Y, Zhu X, Yan H, Huang LE. Acta Neuropathol. 2018 Feb;135(2):285-298. doi: 10.1007/s00401-017-1800-0. Epub 2017 Dec 29. 10.1007/s00401-017-1800-0 [pii] PubMed 29288440