pAAV-hSyn-eGFP-SynaptoZip
(Plasmid
#122525)
-
PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5974
- Total vector size (bp) 7218
-
Modifications to backboneSubstitution of the original promoter with hSyn
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP-SynaptoZip
-
Alt nameGreenZip
-
Alt nameGZ
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1278
-
GenBank IDMF797884
-
Entrez GeneVamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
- Promoter hSyn
-
Tags
/ Fusion Proteins
- eGFP (N terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCAGCACGACTTCTTCAAGTC
- 3′ sequencing primer ATTGGTTAAATCCAAGGGAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-eGFP-SynaptoZip was a gift from Antonio Malgaroli (Addgene plasmid # 122525 ; http://n2t.net/addgene:122525 ; RRID:Addgene_122525) -
For your References section:
Functional mapping of brain synapses by the enriching activity-marker SynaptoZip. Ferro M, Lamanna J, Ripamonti M, Racchetti G, Arena A, Spadini S, Montesano G, Cortese R, Zimarino V, Malgaroli A. Nat Commun. 2017 Oct 31;8(1):1229. doi: 10.1038/s41467-017-01335-4. 10.1038/s41467-017-01335-4 PubMed 29089485