Skip to main content

pAd5-B1
(Plasmid #122551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2988
  • Total vector size (bp) 6747
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Adenovirus 5 genomic region 1-3759
  • Species
    Adenovirus 5
  • Insert Size (bp)
    3759
  • GenBank ID
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd5-B1 was a gift from Fred Bunz (Addgene plasmid # 122551 ; http://n2t.net/addgene:122551 ; RRID:Addgene_122551)
  • For your References section:

    Seamless assembly of recombinant adenoviral genomes from high-copy plasmids. Miciak JJ, Hirshberg J, Bunz F. PLoS One. 2018 Jun 27;13(6):e0199563. doi: 10.1371/journal.pone.0199563. eCollection 2018. 10.1371/journal.pone.0199563 PubMed 29949649
Included in kit:
Commonly requested with: