pAd5-B1-deltaE1-MCS
(Plasmid
#122558)
-
PurposeModified block 1, with deletion in E1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2988
- Total vector size (bp) 3742
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAdenovirus 5 genomic region 1-3759
-
SpeciesAdenovirus 5
-
Insert Size (bp)754
-
MutationAdenovirus sequences 481-3530 replaced with multiple cloning site for transgene insertion
-
GenBank ID
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd5-B1-deltaE1-MCS was a gift from Fred Bunz (Addgene plasmid # 122558 ; http://n2t.net/addgene:122558 ; RRID:Addgene_122558) -
For your References section:
Seamless assembly of recombinant adenoviral genomes from high-copy plasmids. Miciak JJ, Hirshberg J, Bunz F. PLoS One. 2018 Jun 27;13(6):e0199563. doi: 10.1371/journal.pone.0199563. eCollection 2018. 10.1371/journal.pone.0199563 PubMed 29949649