Skip to main content

pKS_3HA_PAC
(Plasmid #122564)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122564 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    bluescript
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • hemagglutinin tag (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CAGTCACGACGTTGTAAAACGA
  • 3′ sequencing primer CATCGTATGGGTACTCCGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKS_3HA_PAC was a gift from Zacheus Cande & Alexander Paredez (Addgene plasmid # 122564 ; http://n2t.net/addgene:122564 ; RRID:Addgene_122564)
  • For your References section:

    Rapid tagging and integration of genes in Giardia intestinalis. Gourguechon S, Cande WZ. Eukaryot Cell. 2011 Jan;10(1):142-5. doi: 10.1128/EC.00190-10. Epub 2010 Nov 29. 10.1128/EC.00190-10 PubMed 21115739