pKS_3HA_PAC
(Plasmid
#122564)
-
Purpose(Empty Backbone) Vector for endogenously tagging Giardia genes with a triple HA tag (Puromycin selection)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122564 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonebluescript
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- hemagglutinin tag (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CAGTCACGACGTTGTAAAACGA
- 3′ sequencing primer CATCGTATGGGTACTCCGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid was generated by Stephane Gourguechon in the lab of Zac Cande (retired).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKS_3HA_PAC was a gift from Zacheus Cande & Alexander Paredez (Addgene plasmid # 122564 ; http://n2t.net/addgene:122564 ; RRID:Addgene_122564) -
For your References section:
Rapid tagging and integration of genes in Giardia intestinalis. Gourguechon S, Cande WZ. Eukaryot Cell. 2011 Jan;10(1):142-5. doi: 10.1128/EC.00190-10. Epub 2010 Nov 29. 10.1128/EC.00190-10 PubMed 21115739