pGT-Ah3
(Plasmid
#122570)
-
PurposeMAGIC donor plasmid (Himar transposon with beta-lactamase/sfGFP payload)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGT-Ah3
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 5749
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namebeta-lactamase/sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1614
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTGGACTCAGAAAGATGAGA
- 3′ sequencing primer GGCCGTTGCTTCGCAACGTT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See supplemental tables of the referenced paper for more information on each plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGT-Ah3 was a gift from Harris Wang (Addgene plasmid # 122570 ; http://n2t.net/addgene:122570 ; RRID:Addgene_122570) -
For your References section:
Metagenomic engineering of the mammalian gut microbiome in situ. Ronda C, Chen SP, Cabral V, Yaung SJ, Wang HH. Nat Methods. 2019 Feb;16(2):167-170. doi: 10.1038/s41592-018-0301-y. Epub 2019 Jan 14. 10.1038/s41592-018-0301-y PubMed 30643213