Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSKAP_AS
(Plasmid #122721)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSKAP
  • Backbone manufacturer
    Shaw and Bourret
  • Backbone size w/o insert (bp) 4703
  • Total vector size (bp) 4728
  • Modifications to backbone
    Addition of AS barcode sequence. TCTCGTAGACAGGAGTTACACTCT
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Barcode AS
  • Insert Size (bp)
    25

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKAP_AS was a gift from Travis Bourret (Addgene plasmid # 122721 ; http://n2t.net/addgene:122721 ; RRID:Addgene_122721)
  • For your References section:

    Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella. Shaw JA, Bourret TJ. J Vis Exp. 2019 May 13;(147). doi: 10.3791/59630. 10.3791/59630 PubMed 31132072