pACT1:Cas9-GFP, U6:sgUPRT
(Plasmid
#122853)
-
PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT gene
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 122853-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 122853-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 9981
-
Vector typeCRISPR ; Cas9-GFP plasmid for genome editing of Cryptosporidium parasites
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9-GFP
-
Speciesstreptococcus pyogenes
-
Insert Size (bp)4956
- Promoter Cryptosporidium parvum actin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCAACACTTAACCTTTCAGT
- 3′ sequencing primer TCAGTTCTATTCTCATTTGAAAGCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-sgUPRT
-
SpeciesCryptosporidium parvum
-
Insert Size (bp)716
- Promoter Cryptosporidium parvum U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGCGCCAAGACCCAG
- 3′ sequencing primer CTATAGTGTCACCTAAATAGCTTGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 122853-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 122853-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACT1:Cas9-GFP, U6:sgUPRT was a gift from David Sibley (Addgene plasmid # 122853 ; http://n2t.net/addgene:122853 ; RRID:Addgene_122853) -
For your References section:
A Stem-Cell-Derived Platform Enables Complete Cryptosporidium Development In Vitro and Genetic Tractability. Wilke G, Funkhouser-Jones LJ, Wang Y, Ravindran S, Wang Q, Beatty WL, Baldridge MT, VanDussen KL, Shen B, Kuhlenschmidt MS, Kuhlenschmidt TB, Witola WH, Stappenbeck TS, Sibley LD. Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007. 10.1016/j.chom.2019.05.007 PubMed 31231046