TK-GFP-Nluc-P2A-neo-TK
(Plasmid
#134896)
-
PurposeExpresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locus
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134896-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134896-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 8663
-
Modifications to backboneNo
-
Vector typeCryptosporidium Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTK-GFP-Nluc-P2A-Neo-TK
-
SpeciesCryptosporidium parvum
-
Insert Size (bp)5961
- Promoter Cryptosporidium actin and enolase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer GAGCTCCATTTGTCCTAACTTCA
- 3′ sequencing primer GGTACCCCTACCATAAGCATCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134896-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134896-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TK-GFP-Nluc-P2A-neo-TK was a gift from David Sibley (Addgene plasmid # 134896 ; http://n2t.net/addgene:134896 ; RRID:Addgene_134896) -
For your References section:
A Stem-Cell-Derived Platform Enables Complete Cryptosporidium Development In Vitro and Genetic Tractability. Wilke G, Funkhouser-Jones LJ, Wang Y, Ravindran S, Wang Q, Beatty WL, Baldridge MT, VanDussen KL, Shen B, Kuhlenschmidt MS, Kuhlenschmidt TB, Witola WH, Stappenbeck TS, Sibley LD. Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007. 10.1016/j.chom.2019.05.007 PubMed 31231046