-
PurposeAAV vector for mapping synaptic projections of infected neurons; expresses tdTomato to reveal neuronal soma and axons, and expresses EGFP fused to Synaptobrevin-2 to track synaptic terminals.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 4561
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-Synaptobrevin-2; tdTomato
-
Insert Size (bp)2576
-
Entrez GeneVamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- tdTomato (P2A cleavage) (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SynaptoTAG2 was a gift from Wei Xu (Addgene plasmid # 175275 ; http://n2t.net/addgene:175275 ; RRID:Addgene_175275) -
For your References section:
Anterograde transneuronal tracing and genetic control with engineered yellow fever vaccine YFV-17D. Li E, Guo J, Oh SJ, Luo Y, Oliveros HC, Du W, Arano R, Kim Y, Chen YT, Eitson J, Lin DT, Li Y, Roberts T, Schoggins JW, Xu W. Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9. 10.1038/s41592-021-01319-9 PubMed 34824475