Skip to main content

Flag-hRPGRIP1L
(Plasmid #122988)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122988 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCD-betaG-FLAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPGRIP1L
  • Species
    H. sapiens (human)
  • Entrez Gene
    RPGRIP1L (a.k.a. CORS3, FTM, JBTS7, MKS5, NPHP8, PPP1R134)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (destroyed during cloning)
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

hRPGRIP1L contains 4 AA changes compared to NP_056087.2 that do not impact the function of the construct.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-hRPGRIP1L was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122988 ; http://n2t.net/addgene:122988 ; RRID:Addgene_122988)