-
PurposeBacterial expression plasmid for wild-type Bxb1 with a C-terminal His-tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 6600
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBxb1 integrase
-
SpeciesMycobacterium smegmatis
-
Insert Size (bp)1500
-
GenBank ID920117
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAAACAAGCGCTCATGAGCCCGAA
- 3′ sequencing primer GTCCCATTCGCCAATCCGGATATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Bxb1-His was a gift from David Liu (Addgene plasmid # 123132 ; http://n2t.net/addgene:123132 ; RRID:Addgene_123132) -
For your References section:
High-resolution specificity profiling and off-target prediction for site-specific DNA recombinases. Bessen JL, Afeyan LK, Dancik V, Koblan LW, Thompson DB, Leichner C, Clemons PA, Liu DR. Nat Commun. 2019 Apr 26;10(1):1937. doi: 10.1038/s41467-019-09987-0. 10.1038/s41467-019-09987-0 PubMed 31028261