pCMV-Brec1
(Plasmid
#123135)
-
PurposeMammalian expression vector for Brec1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrec1 recombinase
-
Insert Size (bp)1032
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV
- 3′ sequencing primer TGGTTCTTTCCGCCTCAGAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Brec1 was a gift from David Liu (Addgene plasmid # 123135 ; http://n2t.net/addgene:123135 ; RRID:Addgene_123135) -
For your References section:
High-resolution specificity profiling and off-target prediction for site-specific DNA recombinases. Bessen JL, Afeyan LK, Dancik V, Koblan LW, Thompson DB, Leichner C, Clemons PA, Liu DR. Nat Commun. 2019 Apr 26;10(1):1937. doi: 10.1038/s41467-019-09987-0. 10.1038/s41467-019-09987-0 PubMed 31028261