PB-ReNL
(Plasmid
#123138)
-
PurposePiggybac transposon plasmid for live animal optical imaging of Red-enhanced nanolantern
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGFP
- Backbone size w/o insert (bp) 5572
- Total vector size (bp) 7490
-
Modifications to backbonePiggybac transposon terminal repeats flank gene casette
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRed-enhanced Nanolantern
-
Alt nameReNL
-
SpeciesSynthetic
-
Insert Size (bp)1910
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer AAGATCTCAGTGGTATTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-ReNL was a gift from Jordan Green (Addgene plasmid # 123138 ; http://n2t.net/addgene:123138 ; RRID:Addgene_123138) -
For your References section:
Photocrosslinked Bioreducible Polymeric Nanoparticles for Enhanced Systemic siRNA Delivery as Cancer Therapy. Karlsson J, Tzeng SY, Hemmati S, Luly KM, Choi O, Rui Y, Wilson DR, Kozielski KL, Quinones-Hinojosa A, Green JJ. Adv Funct Mater. 2021 Apr 22;31(17). doi: 10.1002/adfm.202009768. Epub 2021 Feb 22. 10.1002/adfm.202009768 PubMed 34650390