Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

As4
(Plasmid #123161)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123161 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB4A3
  • Backbone size w/o insert (bp) 3339
  • Total vector size (bp) 4936
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    J115-30arsR-t-ParsR-30gfp-t
  • Species
    Synthetic
  • Insert Size (bp)
    1597
  • Promoter J115, ParsR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    As4 was a gift from Baojun Wang (Addgene plasmid # 123161 ; http://n2t.net/addgene:123161 ; RRID:Addgene_123161)
  • For your References section:

    Cascaded amplifying circuits enable ultrasensitive cellular sensors for toxic metals. Wan X, Volpetti F, Petrova E, French C, Maerkl SJ, Wang B. Nat Chem Biol. 2019 May;15(5):540-548. doi: 10.1038/s41589-019-0244-3. Epub 2019 Mar 25. 10.1038/s41589-019-0244-3 PubMed 30911179