Skip to main content
Addgene

As5 (pBW414J105-arsR)
(Plasmid #123162)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123162 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB3K3
  • Backbone size w/o insert (bp) 2750
  • Total vector size (bp) 4347
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    J105-30arsR-t-ParsR-30gfp-t
  • Species
    Synthetic
  • Insert Size (bp)
    1597
  • Promoter J105, ParsR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    From Dr Baojun Wang's publication: Wang, B., Barahona, M. & Buck, M. Amplification of small molecule-inducible gene expression via tuning of intracellular receptor densities. Nucleic Acids Res. 43, 1955–1964 (2015).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    As5 (pBW414J105-arsR) was a gift from Baojun Wang (Addgene plasmid # 123162 ; http://n2t.net/addgene:123162 ; RRID:Addgene_123162)
  • For your References section:

    Cascaded amplifying circuits enable ultrasensitive cellular sensors for toxic metals. Wan X, Volpetti F, Petrova E, French C, Maerkl SJ, Wang B. Nat Chem Biol. 2019 May;15(5):540-548. doi: 10.1038/s41589-019-0244-3. Epub 2019 Mar 25. 10.1038/s41589-019-0244-3 PubMed 30911179