pRC10-EFS-huLbCpf1-2A-Blast-WPRE
(Plasmid #123359)

• Purpose: Lentiviral vector to constitutively express humanized LbCpf1/Cas12a, with blasticidin resistance for selection.
• Depositing Lab: Sidi Chen
• Publication: Chow et al Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 10130
• Total vector size (bp): 12411
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human codon-optimized Cpf1/Cas12a from Lachnospiraceae bacterium,
• Alt name: huLbCpf1
• Alt name: huLbCas12a
• Species: Synthetic
• Insert Size (bp): 3684
• Promoter: EFS-NS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCCCACAGTCCCCGAGAAGTT
• 3′ sequencing primer: gcaccacgagttctgcacaaggt

Resource Information

• Supplemental Documents:
  • pRC10-EFS-huLbCpf1-2A-Blast-WPRE.gbk
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry