-
PurposeLentiviral vector to constitutively express humanized LbCpf1/Cas12a, with blasticidin resistance for selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 10130
- Total vector size (bp) 12411
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon-optimized Cpf1/Cas12a from Lachnospiraceae bacterium,
-
Alt namehuLbCpf1
-
Alt namehuLbCas12a
-
SpeciesSynthetic
-
Insert Size (bp)3684
- Promoter EFS-NS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCCACAGTCCCCGAGAAGTT
- 3′ sequencing primer gcaccacgagttctgcacaaggt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRC10-EFS-huLbCpf1-2A-Blast-WPRE was a gift from Sidi Chen (Addgene plasmid # 123359 ; http://n2t.net/addgene:123359 ; RRID:Addgene_123359) -
For your References section:
In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Chow RD, Wang G, Ye L, Codina A, Kim HR, Shen L, Dong MB, Errami Y, Chen S. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. 10.1038/s41592-019-0371-5 PubMed 30962622