pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40]
(Plasmid
#124068)
-
PurposeCRISPR/Cas mediated knock-in via non-homologous end-joining in Tribolium; bhsp drives EGFP expression; Dm-ebony for linearization; (Transformation plasmid; Black eye marker)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJET1.2
- Backbone size w/o insert (bp) 2990
- Total vector size (bp) 6851
-
Vector typeInsect Expression, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeb-Tc’bhsp-EGFP-2A-Cre; 3xP3-gTc’v-SV40
-
Insert Size (bp)3861
- Promoter bhsp68
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer GAAGAACATCGATTTTCCATGGC
- 3′ sequencing primer TAATACGACTCACTATAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40] was a gift from Gregor Bucher (Addgene plasmid # 124068 ; http://n2t.net/addgene:124068 ; RRID:Addgene_124068) -
For your References section:
An ancestral apical brain region contributes to the central complex under the control of foxQ2 in the beetle Tribolium. He B, Buescher M, Farnworth MS, Strobl F, Stelzer EH, Koniszewski ND, Muehlen D, Bucher G. Elife. 2019 Oct 18;8. pii: 49065. doi: 10.7554/eLife.49065. 10.7554/eLife.49065 PubMed 31625505