Skip to main content

pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre; ye-3xP3-gTc’v-SV40]
(Plasmid #124069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124069 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJET1.2
  • Backbone size w/o insert (bp) 2990
  • Total vector size (bp) 6876
  • Vector type
    Insect Expression, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eb-Tc’bhsp-EGFP-2A-Cre; ye-3xP3-gTc’v-SV40
  • Insert Size (bp)
    3884
  • Promoter bhsp68

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer GAAGAACATCGATTTTCCATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre; ye-3xP3-gTc’v-SV40] was a gift from Gregor Bucher (Addgene plasmid # 124069 ; http://n2t.net/addgene:124069 ; RRID:Addgene_124069)