pJV132
(Plasmid
#124254)
-
PurposeLentiviral vector (pRRL) containing KRAS G12V specific T cell receptor, clone 3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRRLsin
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT cell receptor
-
SpeciesH. sapiens (human)
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter MSCV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgcttctgttcgcgcgctt
- 3′ sequencing primer AACAGGCACACGCTCTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJV132 was a gift from Stanley Riddell (Addgene plasmid # 124254 ; http://n2t.net/addgene:124254 ; RRID:Addgene_124254) -
For your References section:
Endogenous CD4(+) T Cells Recognize Neoantigens in Lung Cancer Patients, Including Recurrent Oncogenic KRAS and ERBB2 (Her2) Driver Mutations. Veatch JR, Jesernig BL, Kargl J, Fitzgibbon M, Lee SM, Baik C, Martins R, Houghton AM, Riddell SR. Cancer Immunol Res. 2019 Jun;7(6):910-922. doi: 10.1158/2326-6066.CIR-18-0402. Epub 2019 May 1. 10.1158/2326-6066.CIR-18-0402 PubMed 31043415