Skip to main content

pBHSTC97
(Plasmid #124352)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124352 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSTC3.1
  • Backbone manufacturer
    Delphi Genetics
  • Backbone size w/o insert (bp) 2586
  • Total vector size (bp) 3039
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NpuDnaBΔ283 mini-intein
  • Species
    Nostoc punctiforme
  • Insert Size (bp)
    453
  • Mutation
    Deletion of 283-residue endonuclease domain
  • GenBank ID
    CP001037.1
  • Promoter STC
  • Tag / Fusion Protein
    • CcdA-C (SFAD) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site blunt (destroyed during cloning)
  • 3′ cloning site blunt (destroyed during cloning)
  • 5′ sequencing primer TGAGGTCGCCCGGTTTATTG
  • 3′ sequencing primer TGCAGCGCGTTAGAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBHSTC97 was a gift from Hideo Iwai (Addgene plasmid # 124352 ; http://n2t.net/addgene:124352 ; RRID:Addgene_124352)
  • For your References section:

    Off-pathway-sensitive protein splicing screening based on a toxin/antitoxin system. Beyer HM, Iwai H. Chembiochem. 2019 Apr 8. doi: 10.1002/cbic.201900139. 10.1002/cbic.201900139 PubMed 30963690
Commonly requested with: