pJET1.2_Bod1l_Anti-Sense
(Plasmid
#124444)
-
PurposePlasmid for anti-sense in situ probe in vitro transcription
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJET1.2/blunt
-
Backbone manufacturerThermo Scientific (CloneJET PCR Cloning Kit)
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 3847
-
Vector typeIn situ probe
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBiorientation of chromosomes in cell division 1-like
-
Alt nameBod1l
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)873
-
Entrez GeneBod1l (a.k.a. A230054D04Rik, AI853319, FAM44A, mKIAA1327)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET1.2_Bod1l_Anti-Sense was a gift from Yingguang Frank Chan (Addgene plasmid # 124444 ; http://n2t.net/addgene:124444 ; RRID:Addgene_124444) -
For your References section:
An integrative genomic analysis of the Longshanks selection experiment for longer limbs in mice. Castro JP, Yancoskie MN, Marchini M, Belohlavy S, Hiramatsu L, Kucka M, Beluch WH, Naumann R, Skuplik I, Cobb J, Barton NH, Rolian C, Chan YF. Elife. 2019 Jun 6;8:e42014. doi: 10.7554/eLife.42014. 10.7554/eLife.42014 PubMed 31169497