pGWB12_TtNAM-B1
(Plasmid
#124573)
-
PurposeExpresses full-length TtNAM-B1 with an N-terminal FLAG tag under the 35s promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGWB12
- Backbone size w/o insert (bp) 15622
- Total vector size (bp) 16840
-
Modifications to backboneN/A
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTaNAM-B1
-
Alt nameTaGPC-B1
-
SpeciesTriticum turgidum ssp. dicoccoides
-
Insert Size (bp)1218
-
GenBank IDDQ869673.1
- Promoter 35s
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGGCAGCTCCGACTCA
- 3′ sequencing primer TCAGGGATTCCAGTTCACGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/573881v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGWB12_TtNAM-B1 was a gift from Cristobal Uauy (Addgene plasmid # 124573 ; http://n2t.net/addgene:124573 ; RRID:Addgene_124573) -
For your References section:
Conserved residues in the wheat (Triticum aestivum) NAM-A1 NAC domain are required for protein binding and when mutated lead to delayed peduncle and flag leaf senescence. Harrington SA, Overend LE, Cobo N, Borrill P, Uauy C. BMC Plant Biol. 2019 Sep 18;19(1):407. doi: 10.1186/s12870-019-2022-5. 10.1186/s12870-019-2022-5 PubMed 31533618