Skip to main content
Addgene

MS2_adRNA-MCP_ADAR1 DD (E1008Q)_NLS
(Plasmid #124626)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124626 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    Unknown
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MCP_ADAR1 DD (E1008Q)_NLS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1752
  • Mutation
    E1008Q hyperactive mutant
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TCCTTCCGTGTTTCAGTTAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also expresses MS2_adRNA targeting the RAB7A transcript

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS2_adRNA-MCP_ADAR1 DD (E1008Q)_NLS was a gift from Prashant Mali (Addgene plasmid # 124626 ; http://n2t.net/addgene:124626 ; RRID:Addgene_124626)
  • For your References section:

    In vivo RNA editing of point mutations via RNA-guided adenosine deaminases. Katrekar D, Chen G, Meluzzi D, Ganesh A, Worlikar A, Shih YR, Varghese S, Mali P. Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8. 10.1038/s41592-019-0323-0 PubMed 30737497