Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

B4GALT1-ABA
(Plasmid #124639)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124639 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Beta-(1,4)-Galactosyltransferase 1
  • Alt name
    b4GALT1
  • Species
    Cricetulus griseus
  • Insert Size (bp)
    1182
  • Promoter PhlF-activatable promoter (6x PhlF Operators + miniCMV promoter)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCACAGTCAATGAAGTTTGAAAACCAATAAGAGCTCGGTAAACC
  • 3′ sequencing primer GGATCTTAAAAACATTATACAATACTACAAGCATAAAAACGCACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NLS-VP16-PYL1
  • Insert Size (bp)
    831
  • Promoter hEF1a

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTGCGTTTTTATGCTTGTAGTATTGTATAATGTTTTTAAGATCC
  • 3′ sequencing primer GGCGTATAAAACATCTGGATAAGACGAGAGATTGGGTATTAGACC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    PhlF(activator)-NES-Gal4-ABI
  • Insert Size (bp)
    1572
  • Promoter hEF1a

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTCTAATACCCAATCTCTCGTCTTATCCAGATGTTTTATACGCC
  • 3′ sequencing primer GGGACAAACTCGCCTGCCTTTTACACTCACATAAGGGAATTCACC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    TagFP635
  • Alt name
    mKate
  • Insert Size (bp)
    713
  • Promoter hEF1a

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTGAATTCCCTTATGTGAGTGTAAAAGGCAGGCGAGTTTGTCCC
  • 3′ sequencing primer GGATTCTTTGAGAGTGCTTTCCAATTACTGCTTTTGCAAGCAACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B4GALT1-ABA was a gift from Ron Weiss (Addgene plasmid # 124639)
  • For your References section:

    Small-molecule control of antibody N-glycosylation in engineered mammalian cells. Chang MM, Gaidukov L, Jung G, Tseng WA, Scarcelli JJ, Cornell R, Marshall JK, Lyles JL, Sakorafas P, Chu AA, Cote K, Tzvetkova B, Dolatshahi S, Sumit M, Mulukutla BC, Lauffenburger DA, Figueroa B Jr, Summers NM, Lu TK, Weiss R. Nat Chem Biol. 2019 May 20. pii: 10.1038/s41589-019-0288-4. doi: 10.1038/s41589-019-0288-4. 10.1038/s41589-019-0288-4 PubMed 31110306