pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
(Plasmid
#124860)
-
PurposeMutagenesis of Slc17a6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX601
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSlc17a6
-
gRNA/shRNA sequenceTATGCTGATCCCATCTGCAGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneSlc17a6 (a.k.a. 2900073D12Rik, DNPI, VGLUT2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6 was a gift from Larry Zweifel (Addgene plasmid # 124860 ; http://n2t.net/addgene:124860 ; RRID:Addgene_124860) -
For your References section:
Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Hunker AC, Soden ME, Krayushkina D, Heymann G, Awatramani R, Zweifel LS. Cell Rep. 2020 Mar 24;30(12):4303-4316.e6. doi: 10.1016/j.celrep.2020.02.092. 10.1016/j.celrep.2020.02.092 PubMed 32209486