pMan operon
(Plasmid
#124888)
-
PurposeExpresses proteins encoding Man operon in E. faecalis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepND50
- Total vector size (bp) 9018
-
Vector typeBacterial Expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemanX1, manX2, manY, manZ, manO, EF0025
-
Alt namemanX1, manX2, manY, manZ, manO, EF0025
-
Alt nameMan operon
-
SpeciesE. faecalis
-
Insert Size (bp)5266
-
GenBank IDNP_813830.1, NP_813831.1, NP_813832.1, NP_813833.1, NP_813834.1, and NP_813835.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCCGGGGATCCTCTGCTCTTAATATGGATATTCCAGCAGAAGAA
- 3′ sequencing primer CTGCAGGTCGACTCTAAAATTTTAGTTCCCGTAGCGATTATCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMan operon was a gift from Kazuhisa Sekimizu (Addgene plasmid # 124888 ; http://n2t.net/addgene:124888 ; RRID:Addgene_124888) -
For your References section:
Enterococcus faecalis YM0831 suppresses sucrose-induced hyperglycemia in a silkworm model and in humans. Matsumoto Y, Ishii M, Hasegawa S, Sekimizu K. Commun Biol. 2019 May 2;2:157. doi: 10.1038/s42003-019-0407-5. eCollection 2019. 10.1038/s42003-019-0407-5 PubMed 31069266